Skip to main content
Addgene

tetO-Fzd1-IRES-tdTomato (TET006)
(Plasmid #160510)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160510 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    tetO-V1rj3-IRES-tdTomato
  • Backbone manufacturer
    Yu lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fzd1
  • Alt name
    Frizzled 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1929
  • Entrez Gene
    Fzd1 (a.k.a. AW227548, FZ-1, Fz1)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Chris Garcia & Jeremy Nathans (Addgene #42253)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.03.29.486284 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tetO-Fzd1-IRES-tdTomato (TET006) was a gift from C. Ron Yu (Addgene plasmid # 160510 ; http://n2t.net/addgene:160510 ; RRID:Addgene_160510)
  • For your References section:

    Molecular Control of Circuit Plasticity and the Permanence of Imprinted Odor Memory. Wu Y, Ma L, Qiu Q, Xu W, Misra A, Duyck K, Blanck J, Scott AR, Chen S, Hassan H, Corbin TJ, Moran A, Hall K, Li H, Perera A, Yu CR. bioRxiv 2022 10.1101/2022.03.29.486284