tetO-Fzd1-IRES-tdTomato (TET006)
(Plasmid
#160510)
-
PurposeThis plasmid expresses Fzd1 under the activation of tTA trans-activator along with fluorescent marker tdTomato.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonetetO-V1rj3-IRES-tdTomato
-
Backbone manufacturerYu lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFzd1
-
Alt nameFrizzled 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1929
-
Entrez GeneFzd1 (a.k.a. AW227548, FZ-1, Fz1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChris Garcia & Jeremy Nathans (Addgene #42253)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.03.29.486284 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tetO-Fzd1-IRES-tdTomato (TET006) was a gift from C. Ron Yu (Addgene plasmid # 160510 ; http://n2t.net/addgene:160510 ; RRID:Addgene_160510) -
For your References section:
Molecular Control of Circuit Plasticity and the Permanence of Imprinted Odor Memory. Wu Y, Ma L, Qiu Q, Xu W, Misra A, Duyck K, Blanck J, Scott AR, Chen S, Hassan H, Corbin TJ, Moran A, Hall K, Li H, Perera A, Yu CR. bioRxiv 2022 10.1101/2022.03.29.486284