HA-Cer-NCreIntN
(Plasmid
#160505)
-
PurposeExpresses NCreIntN, tagged with HA, in mammalian cells in split intein-mediated split-Cre recombinase applications
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6387
-
Vector typeMammalian Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNCreIntN
-
SpeciesSynthetic
-
Insert Size (bp)555
- Promoter CMV
-
Tag
/ Fusion Protein
- HA
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-Cer-NCreIntN was a gift from Shawn Je (Addgene plasmid # 160505 ; http://n2t.net/addgene:160505 ; RRID:Addgene_160505) -
For your References section:
Neural circuit analysis using a novel intersectional split intein-mediated split-Cre recombinase system. Khoo ATT, Kim PJ, Kim HM, Je HS. Mol Brain. 2020 Jul 2;13(1):101. doi: 10.1186/s13041-020-00640-2. 10.1186/s13041-020-00640-2 PubMed 32616061