pQE-60NA-proinsulin-msGFP2
(Plasmid
#160466)
-
PurposeEncodes a fusion of human proinsulin and the monomeric superfolder GFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePQE-60NA
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 4371
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameproinsulin-msGFP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)972
- Promoter T5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGATTCAATTGTGAGCGGATAACAATTTC
- 3′ sequencing primer TGAGGTCATTACTGGATCTATCAACAGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE-60NA-proinsulin-msGFP2 was a gift from Benjamin Glick (Addgene plasmid # 160466 ; http://n2t.net/addgene:160466 ; RRID:Addgene_160466) -
For your References section:
A photostable monomeric superfolder GFP. Valbuena FM, Fizgerald I, Strack RL, Andruska N, Smith L, Glick BS. Traffic. 2020 May 15. doi: 10.1111/tra.12737. 10.1111/tra.12737 PubMed 32415747