pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo
(Plasmid #160458)

• Purpose: Homology-directed recombination donor vector for EGFP reporter knock-in to human PAX7 3' UTR
• Depositing Lab: April Pyle
• Publication: Xi et al STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18.

Backbone

• Vector backbone: Oct4-IRES-eGFP-PGK-Neo
• Backbone manufacturer: 48681
• Backbone size w/o insert (bp): 5978
• Total vector size (bp): 7328
• Modifications to backbone: The homology arms of mouse Oct4 in the backbone vector are replaced by human PAX7 homology arms
• Vector type: Insertion of a fluorescent reporter through homology-directed recombination
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PAX7 Left/5' Homology Arm
• Species: H. sapiens (human)
• Insert Size (bp): 650
• GenBank ID: NM_001135254
• Entrez Gene: PAX7 (a.k.a. CMYP19, HUP1, MYOSCO, PAX7B, RMS2)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13R: CAGGAAACAGCTATGAC
• 3′ sequencing primer: AAAGGAATGCAAGGTCTGTT

Gene/Insert 2

• Gene/Insert name: PAX7 Right/3' Homology Arm
• Species: H. sapiens (human)
• Insert Size (bp): 700
• GenBank ID: NM_001135254
• Entrez Gene: PAX7 (a.k.a. CMYP19, HUP1, MYOSCO, PAX7B, RMS2)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: NeoF: CGTTGGCTACCCGTGATATT
• 3′ sequencing primer: M13(-47): GTTTTCCCAGTCACGAC

Resource Information

• Supplemental Documents:
  • pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry