Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo
(Plasmid #160458)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160458 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Oct4-IRES-eGFP-PGK-Neo
  • Backbone manufacturer
    48681
  • Backbone size w/o insert (bp) 5978
  • Total vector size (bp) 7328
  • Modifications to backbone
    The homology arms of mouse Oct4 in the backbone vector are replaced by human PAX7 homology arms
  • Vector type
    Insertion of a fluorescent reporter through homology-directed recombination
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PAX7 Left/5' Homology Arm
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    650
  • GenBank ID
    NM_001135254
  • Entrez Gene
    PAX7 (a.k.a. CMYP19, HUP1, MYOSCO, PAX7B, RMS2)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer M13R: CAGGAAACAGCTATGAC
  • 3′ sequencing primer AAAGGAATGCAAGGTCTGTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PAX7 Right/3' Homology Arm
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    700
  • GenBank ID
    NM_001135254
  • Entrez Gene
    PAX7 (a.k.a. CMYP19, HUP1, MYOSCO, PAX7B, RMS2)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer NeoF: CGTTGGCTACCCGTGATATT
  • 3′ sequencing primer M13(-47): GTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHX_HDR_hPAX7_IRES-EGFP-PGK-Neo was a gift from April Pyle (Addgene plasmid # 160458 ; http://n2t.net/addgene:160458 ; RRID:Addgene_160458)
  • For your References section:

    Generation of PAX7 Reporter Cells to Investigate Skeletal Myogenesis from Human Pluripotent Stem Cells. Xi H, Young CS, Pyle AD. STAR Protoc. 2020 Nov 5;1(3):100158. doi: 10.1016/j.xpro.2020.100158. eCollection 2020 Dec 18. 10.1016/j.xpro.2020.100158 PubMed 33377052