pDEST-Tol2-PA2-CMV-AB-mCh
(Plasmid #160435)

• Purpose: Expresses human Amyloid Beta-mCherry in Zebrafish
• Depositing Lab: Nicholas Tolwinski
• Publication: Kaur et al Bio Protoc. 2020 Dec 5;10(23):e3856. doi: 10.21769/BioProtoc.3856. eCollection 2020 Dec 5.

Backbone

• Vector backbone: pDEST-Tol2-PA2
• Total vector size (bp): 5148
• Vector type: Zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human Amyloid Beta peptide (1-42)
• Alt name: Homo sapiens amyloid beta precursor protein
• Species: H. sapiens (human), D. rerio (zebrafish)
• Entrez Gene: APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: hAmyloid Beta_fwd: ataagcagagctatggatgcagaattccgacatgactcag
• 3′ sequencing primer: mCherry_rev: tatcttatcatgtctggatcatcatgtacagctcgtccatgccgccggtg

Resource Information

• Supplemental Documents:
  • pDEST-Tol2-PA2-CMV-AB-mCh.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry