AlkB-D135G
(Plasmid #160434)

• Purpose: A plasmid for expression in E. coli to produce His-tag fusion protein AlkB with Asp at position 135 mutated to Gly
• Depositing Lab: Tao Pan
• Publication: Wang et al Nucleic Acids Res. 2021 Mar 18;49(5):e30. doi: 10.1093/nar/gkaa1213.

Backbone

• Vector backbone: pET-28a(+)
• Backbone size w/o insert (bp): 5295
• Total vector size (bp): 5913
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E. coli AlkB
• Species: Escherichia coli
• Insert Size (bp): 618
• Mutation: Changed Aspartic acid 135 to Glycine; deleted the first 11 amino acids
• GenBank ID: NC_000913.3
• Promoter: T7
• Tag / Fusion Protein:
  • His-tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry