AlkB-D135G
(Plasmid
#160434)
-
PurposeA plasmid for expression in E. coli to produce His-tag fusion protein AlkB with Asp at position 135 mutated to Gly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-28a(+)
- Backbone size w/o insert (bp) 5295
- Total vector size (bp) 5913
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE. coli AlkB
-
SpeciesEscherichia coli
-
Insert Size (bp)618
-
MutationChanged Aspartic acid 135 to Glycine; deleted the first 11 amino acids
-
GenBank IDNC_000913.3
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AlkB-D135G was a gift from Tao Pan (Addgene plasmid # 160434 ; http://n2t.net/addgene:160434 ; RRID:Addgene_160434) -
For your References section:
A high-throughput screening method for evolving a demethylase enzyme with improved and new functionalities. Wang Y, Katanski CD, Watkins C, Pan JN, Dai Q, Jiang Z, Pan T. Nucleic Acids Res. 2021 Mar 18;49(5):e30. doi: 10.1093/nar/gkaa1213. 10.1093/nar/gkaa1213 PubMed 33337498