pBAC690-TEF
(Plasmid
#160432)
-
PurposeExpresses eGFP under control of the yeast TEF2 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160432 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFA6a–link–yEGFP–Kan
- Backbone size w/o insert (bp) 4894
- Total vector size (bp) 5400
-
Vector typeYeast Expression
-
Selectable markersKanamycin used with growth in yeast
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameS. cerevisiae TEF2 promoter
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)674
- Promoter S. cerevisiae TEF2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTTTGTTATGTAGAGTTTTTTTAGCTACC
- 3′ sequencing primer CATGTTTAGTTAATTATAGTTCGTTGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOriginal plasmid was obtained from EUROSCARF. We cloned the TEF2 promoter from yeast genomic DNA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.05.11.089300v1 for bioRxiv preprint.
Parent vector is described in "Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae", Mark A Sheff , Kurt S ThornYeast 2004 Jun;21(8):661-70. doi: 10.1002/yea.1130. The parent vector was intended for GFP tagging of yeast proteins. We placed the TEF2 promoter directly upstream of GFP for sugar-insensitive expression of GFP under galactose or dextrose conditions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAC690-TEF was a gift from Gary Stormo (Addgene plasmid # 160432 ; http://n2t.net/addgene:160432 ; RRID:Addgene_160432) -
For your References section:
Autoregulation of yeast ribosomal proteins discovered by efficient search for feedback regulation. Roy B, Granas D, Bragg F Jr, Cher JAY, White MA, Stormo GD. Commun Biol. 2020 Dec 11;3(1):761. doi: 10.1038/s42003-020-01494-z. 10.1038/s42003-020-01494-z PubMed 33311538