pPICZ-aC-VTS-US
(Plasmid #160425)

• Purpose: Expression of c-luciferase from sp. Vargula tsujii (USA)
• Depositing Lab: Todd Oakley
• Publication: Hensley et al Mol Ecol. 2020 Oct 8. doi: 10.1111/mec.15673.

Backbone

• Vector backbone: pPICZ-alphaC
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 3600
• Total vector size (bp): 5200
• Vector type: Yeast Expression, Luciferase
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: luciferase
• Alt name: Luciferin 2 mono-oxygenase
• Species: Vargula tsujii
• Insert Size (bp): 1605
• Mutation: See depositor comments below
• GenBank ID: 335805
• Promoter: AOX
• Tags / Fusion Proteins:
  • Yeast alpha secretion factor (N terminal on backbone)
  • c-myc epitope tag (C terminal on backbone)
  • 6x Histidine tag (C terminal on backbone)
  • stop codon (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TACTATTGCCAGCATTGCTGC
• 3′ sequencing primer: GCAAATGGCATTCTGACATCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a 140bp insertion just downstream of the alpha factor secretion signal that causes a stop codon before Vargula tsujii luciferase and also contains a 6bp deletion that removes Q142-L143 from the ORF compared to the depositor's insert sequence. It is not known how these discrepancies affect the plasmid's function, though the plasmid was functional in the depositor's experiments.