-
PurposeBinary vector pGWB14 including citrus GRF4-GIF1 under 35S promoter/ Plant transformation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGWB14
- Backbone size w/o insert (bp) 17356
- Total vector size (bp) 17363
-
Selectable markersNeomycin (select with G418), Hygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name35S::citrus GRF4-GIF1 chimera
-
SpeciesSynthetic; citrus
- Promoter 35S
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGCCAACTTTGTACaaaaaagcTGCCA
- 3′ sequencing primer TTAATTTCCATCATCAGCCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JD690 was a gift from Jorge Dubcovsky (Addgene plasmid # 160397 ; http://n2t.net/addgene:160397 ; RRID:Addgene_160397) -
For your References section:
A GRF-GIF chimeric protein improves the regeneration efficiency of transgenic plants. Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol. 2020 Oct 12. pii: 10.1038/s41587-020-0703-0. doi: 10.1038/s41587-020-0703-0. 10.1038/s41587-020-0703-0 PubMed 33046875