Skip to main content

JD690
(Plasmid #160397)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160397 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGWB14
  • Backbone size w/o insert (bp) 17356
  • Total vector size (bp) 17363
  • Selectable markers
    Neomycin (select with G418), Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    35S::citrus GRF4-GIF1 chimera
  • Species
    Synthetic; citrus
  • Promoter 35S

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGCCAACTTTGTACaaaaaagcTGCCA
  • 3′ sequencing primer TTAATTTCCATCATCAGCCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JD690 was a gift from Jorge Dubcovsky (Addgene plasmid # 160397 ; http://n2t.net/addgene:160397 ; RRID:Addgene_160397)
  • For your References section:

    A GRF-GIF chimeric protein improves the regeneration efficiency of transgenic plants. Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol. 2020 Oct 12. pii: 10.1038/s41587-020-0703-0. doi: 10.1038/s41587-020-0703-0. 10.1038/s41587-020-0703-0 PubMed 33046875
Commonly requested with: