Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PJD1223
(Plasmid #160390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160390 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PJD1223
  • Backbone manufacturer
    J Virol . 1993 May;67(5):2764-71. doi: 10.1128/JVI.67.5.2764-2771.1993.
  • Backbone size w/o insert (bp) 9854
  • Total vector size (bp) 12223
  • Vector type
    Yeast Expression
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L-A Gag-Pol
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4516
  • Promoter TRP1

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pJD1223-NAT was constructed by short-homology in vivo replacement of TRP1 on pJD1223 (J Virol
. 1993 May;67(5):2764-71) with NAT PCR product generated using primers TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAGCTTGGAGTcagctgaagcttcgtacgc and
caagtgcacaaacaatacttaaataaatactactcagtaataacctattttaggccactagtggatctg from pAG25.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PJD1223 was a gift from John McCusker (Addgene plasmid # 160390 ; http://n2t.net/addgene:160390 ; RRID:Addgene_160390)