Skip to main content
Addgene

pAG25-1199 cDNA
(Plasmid #160379)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160379 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAG25
  • Backbone size w/o insert (bp) 3704
  • Total vector size (bp) 6500
  • Vector type
    Yeast Expression
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N1199
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2800
  • Promoter NA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CGTATGTGAATGCTGGTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

2.8 kb dsRNA species gel purified from yJM 1199 and ligated to PC3 oligo (/5Phos/GG ATC CCG GGA ATT CGG TAA TAC GAC TCA CTA TAT TTT TAT AGT GAG TCG TAT TA). After reverse transcription and strand annealing, cDNA amplified with PC2 primer (CCG AAT TCC CGG GAT CC )to yield a 2.8 kb fragment. Fragment phosphorylated and ligated to pAG25 digested with EcoRV and phosphatase treated. Clones checked with restriction digest and sequencing. Near full length N1199 cDNA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG25-1199 cDNA was a gift from John McCusker (Addgene plasmid # 160379 ; http://n2t.net/addgene:160379 ; RRID:Addgene_160379)
Related items: