Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRK5-α5first
(Plasmid #160269)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160269 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKR5
  • Backbone size w/o insert (bp) 4668
  • Total vector size (bp) 12750
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    α5first concatemer
  • Alt name
    α5-β2-α4-β2-α4 concatemer
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8082
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GCCTTTCTCTCCACAGGTGTCC
  • 3′ sequencing primer GTGAAATTTGTGATGCTATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK5-α5first was a gift from Pierre-Jean Corringer (Addgene plasmid # 160269 ; http://n2t.net/addgene:160269 ; RRID:Addgene_160269)
  • For your References section:

    Concatemers to re-investigate the role of alpha5 in alpha4beta2 nicotinic receptors. Prevost MS, Bouchenaki H, Barilone N, Gielen M, Corringer PJ. Cell Mol Life Sci. 2020 May 29. pii: 10.1007/s00018-020-03558-z. doi: 10.1007/s00018-020-03558-z. 10.1007/s00018-020-03558-z PubMed 32472188