Skip to main content
Addgene

pGEM-T Easy-Cas9-nls-CDS1
(Plasmid #160231)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160231 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGEMT -Easy
  • Backbone size w/o insert (bp) 3015
  • Total vector size (bp) 7245
  • Vector type
    level 0 of MoClo Golden Gate position CDS1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
  • Insert Size (bp)
    4199

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer AATTCGATTATTGGTCTCTAAG
  • 3′ sequencing primer GGCCGCGAATTCACTAGTGAT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEM-T Easy-Cas9-nls-CDS1 was a gift from Matias Kirst (Addgene plasmid # 160231 ; http://n2t.net/addgene:160231 ; RRID:Addgene_160231)

  • For your References section:

    Simple, efficient and open-source CRISPR/Cas9 strategy for multi-site genome editing in Populus tremula x alba. Triozzi P, Schmidt HW, Dervinis C, Kirst M, Conde D. Tree Physiol. 2021 May 7. pii: 6270869. doi: 10.1093/treephys/tpab066. 10.1093/treephys/tpab066 PubMed 33960379
Related items: