CBSH3- shRNA3
(Plasmid
#160212)
-
PurposeKnock Down MYDSH3- Collybistin isoforms
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160212 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemu6pro
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARHGEF9
-
Alt nameCollybistin
-
gRNA/shRNA sequenceTGTATGACCTCTGGGTGAACCA
-
SpeciesH. sapiens (human), R. norvegicus (rat)
-
Entrez GeneArhgef9
- Promoter mouse U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site Xba (unknown if destroyed)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was originally cloned in Angel de Blas's lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Targets collybistin MYD-CBSH3- mRNA (target is located in the protein coding region. Putative rat sequence based on human sequence. Targets nucleotides 809-830 of human NM_001353926.2. Targets MYD collybistin isoforms without SH3 domain). There is also the mutated shRNA control for this isoform (Addgene #160213).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CBSH3- shRNA3 was a gift from Angel de Blas (Addgene plasmid # 160212 ; http://n2t.net/addgene:160212 ; RRID:Addgene_160212) -
For your References section:
Collybistin SH3-protein isoforms are expressed in the rat brain promoting gephyrin and GABA-A receptor clustering at GABAergic synapses. George S, Bear J Jr, Taylor MJ, Kanamalla K, Fekete CD, Chiou TT, Miralles CP, Papadopoulos T, De Blas AL. J Neurochem. 2021 May;157(4):1032-1051. doi: 10.1111/jnc.15270. Epub 2021 Jan 5. 10.1111/jnc.15270 PubMed 33316079