-
PurposeCre- dependent expression of Sun1GFP for nuclei isolation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160141 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-Ef1a-DIO-EGFP-WPRE-pA
-
Backbone manufacturerBernardo Sabatini Lab
- Backbone size w/o insert (bp) 5662
- Total vector size (bp) 6342
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSun1-GFP
-
Alt nameSun1-sfGFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2370
-
MutationN-truncated: removed amino acids 1-207, retained 208-757
-
GenBank IDNM_001256118.1
-
Entrez GeneSun1 (a.k.a. 4632417G13Rik, 5730434D03Rik, Unc84a, mKIAA0810)
- Promoter Ef1a
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SgsI (not destroyed)
- 3′ cloning site BspoI (not destroyed)
- 5′ sequencing primer CCAGCTTGGCACTTGATGTA
- 3′ sequencing primer AGTCATGCCGTTTCATGTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBernardo Sabatini Lab, Harvard University.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA was a gift from Andreas Pfenning (Addgene plasmid # 160141 ; http://n2t.net/addgene:160141 ; RRID:Addgene_160141) -
For your References section:
Cell type-specific oxidative stress genomic signatures in the globus pallidus of dopamine depleted mice. Lawler AJ, Brown AR, Bouchard RS, Toong N, Kim Y, Velraj N, Fox G, Kleyman M, Kang B, Gittis AH, Pfenning AR. J Neurosci. 2020 Nov 10. pii: JNEUROSCI.1634-20.2020. doi: 10.1523/JNEUROSCI.1634-20.2020. 10.1523/JNEUROSCI.1634-20.2020 PubMed 33188066