pT7-SpCas9_sgRNA-site2 (RTW448)
(Plasmid
#160137)
-
PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneDR274 (Addgene plasmid #42250)
-
Vector typein vitro transcription of sgRNA from T7 promoter
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
-
Alt nameRTW448
-
gRNA/shRNA sequenceGTCGCCCTCGAACTTCACCT
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer M13F - TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-SpCas9_sgRNA-site2 (RTW448) was a gift from Keith Joung & Benjamin Kleinstiver (Addgene plasmid # 160137 ; http://n2t.net/addgene:160137 ; RRID:Addgene_160137) -
For your References section:
Scalable characterization of the PAM requirements of CRISPR-Cas enzymes using HT-PAMDA. Walton RT, Hsu JY, Joung JK, Kleinstiver BP. Nat Protoc. 2021 Feb 5. pii: 10.1038/s41596-020-00465-2. doi: 10.1038/s41596-020-00465-2. 10.1038/s41596-020-00465-2 PubMed 33547443