pT7-SpCas9_sgRNA-site1 (RTW443)
(Plasmid #160136)

• Purpose: T7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1
• Depositing Labs: Keith Joung, Benjamin Kleinstiver
• Publication: Walton et al Nat Protoc. 2021 Feb 5. pii: 10.1038/s41596-020-00465-2. doi: 10.1038/s41596-020-00465-2.

Backbone

• Vector backbone: DR274 (Addgene plasmid #42250)
• Vector type: in vitro transcription of sgRNA from T7 promoter

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
• Alt name: RTW443
• gRNA/shRNA sequence: GGGCACGGGCAGCTTGCCGG
• Species: Synthetic
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: M13F - TGTAAAACGACGGCCAGT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry