GPS-MYC
(Plasmid
#160130)
-
PurposeA reporter that monitors MYC protein expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGPS-LP
- Backbone size w/o insert (bp) 8000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMYC
-
Alt namec-MYC
-
SpeciesH. sapiens (human)
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GPS-MYC was a gift from Channing Der (Addgene plasmid # 160130 ; http://n2t.net/addgene:160130 ; RRID:Addgene_160130) -
For your References section:
Application of a MYC degradation screen identifies sensitivity to CDK9 inhibitors in KRAS-mutant pancreatic cancer. Blake DR, Vaseva AV, Hodge RG, Kline MP, Gilbert TSK, Tyagi V, Huang D, Whiten GC, Larson JE, Wang X, Pearce KH, Herring LE, Graves LM, Frye SV, Emanuele MJ, Cox AD, Der CJ. Sci Signal. 2019 Jul 16;12(590). pii: 12/590/eaav7259. doi: 10.1126/scisignal.aav7259. 10.1126/scisignal.aav7259 PubMed 31311847