pTXB1-TP4
(Plasmid #160087)

• Purpose: Bacterial expression of Tn5-APEX2 fusion protein with linker (GGGGS)4
• Depositing Lab: Pier Pandolfi
• Publication: Lee et al Nat Methods. 2021 Mar;18(3):293-302. doi: 10.1038/s41592-021-01077-8. Epub 2021 Mar 1.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6706
• Total vector size (bp): 8913
• Modifications to backbone: None
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Growth at 37°C before IPTG induction. After IPTG addition, grow at 30°C. The Rosetta2 E. coli strain is used for protein expression.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tn5 transposase/APEX2 peroxidase fusion protein
• Species: Synthetic
• Insert Size (bp): 2235
• Tags / Fusion Proteins:
  • FLAG (C terminal on insert)
  • Mxe intein - Chitin-binding domain (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7 promoter primer
• 3′ sequencing primer: GATTGCCATGCCGGTCAAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pTXB1-Tn5 (Addgene #60240) and pTRC-APEX2 (Addgene #72558)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry