Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CBSH3+ shRNA-1
(Plasmid #160066)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160066 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mu6pro
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARHGEF9
  • Alt name
    Collybistin
  • gRNA/shRNA sequence
    GGATGCTTCCAACAAGGATTG
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Arhgef9
  • Promoter mouse U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site Xba (unknown if destroyed)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was originally cloned in Angel de Blas's lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Targets collybistin SH3+ mRNAs (target is located in the protein coding region of SH3+. Nucleotides 517-537 of AJ250425 [CB1SH3+]. Targets collybistin isoforms with SH3 domain). There is also a control mutated shRNA for this isoform (Addgene plasmid #160067).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CBSH3+ shRNA-1 was a gift from Angel de Blas (Addgene plasmid # 160066 ; http://n2t.net/addgene:160066 ; RRID:Addgene_160066)
  • For your References section:

    Collybistin SH3-protein isoforms are expressed in the rat brain promoting gephyrin and GABA-A receptor clustering at GABAergic synapses. George S, Bear J Jr, Taylor MJ, Kanamalla K, Fekete CD, Chiou TT, Miralles CP, Papadopoulos T, De Blas AL. J Neurochem. 2021 May;157(4):1032-1051. doi: 10.1111/jnc.15270. Epub 2021 Jan 5. 10.1111/jnc.15270 PubMed 33316079