vYM133_PB-pEF-osTIR1-T2A-iaaH-T2A-mGFPmut3-mAID-iCasp9-T2A-mCh-AID-BlastR
(Plasmid
#160046)
-
PurposeFor expressing the full paradoxical circuit
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePiggyBac
-
Backbone manufacturerSYSTEM BIOSCIENCES
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameosTIR1
-
SpeciesOryza Sativa (Asian rice)
-
Insert Size (bp)1725
- Promoter pEF1s
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGACATACTTTCCTGAAGAGGTCGTC
- 3′ sequencing primer CAGAATCTTCACAAAGTTGGGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameiaaH
-
Insert Size (bp)1401
- Promoter no promoter, T2A is used
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cttggtaccgagctcggatccaactcgaggccaccatgGTAGCCATCACGTCACTGGCCC
- 3′ sequencing primer CCACATCCCCGCAAGTAAGCAGTGATCCGCGTCCCTCggtGTTCGGAAGTCCAGCGAAAT (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameiCasp9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1236
- Promoter no promoter, T2A is used
-
Tags
/ Fusion Proteins
- mGFPmut3 (N terminal on insert)
- mAID (N terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer atggctagcaaaggtGAGGAG
- 3′ sequencing primer gtcgagtgcgtagtctggtacgtcgtacggatag (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameBlastR
-
Alt nameBSD
-
SpeciesSynthetic; Aspergillus terreus
-
Insert Size (bp)396
- Promoter no promoter, T2A is used
-
Tags
/ Fusion Proteins
- mCherry (N terminal on insert)
- mAID (N terminal on insert)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgagcaagggcgaggagg
- 3′ sequencing primer taagctgcaataaacaagttgTCAgccctcccacacataacca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
osTIR1 is cloned from #72834
mAID is cloned from #72827
iCasp9 is cloned from #15567
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vYM133_PB-pEF-osTIR1-T2A-iaaH-T2A-mGFPmut3-mAID-iCasp9-T2A-mCh-AID-BlastR was a gift from Michael Elowitz (Addgene plasmid # 160046 ; http://n2t.net/addgene:160046 ; RRID:Addgene_160046) -
For your References section:
Synthetic mammalian signaling circuits for robust cell population control. Ma Y, Budde MW, Mayalu MN, Zhu J, Lu AC, Murray RM, Elowitz MB. Cell. 2022 Mar 17;185(6):967-979.e12. doi: 10.1016/j.cell.2022.01.026. Epub 2022 Mar 1. 10.1016/j.cell.2022.01.026 PubMed 35235768