vYM140_PB-pEFa1-iaaM(P.s)-Hygro
(Plasmid
#160043)
-
PurposeExpressing iaaM for converting L-Trp to IAM
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePiggyBac
-
Backbone manufacturerSYSTEM BIOSCIENCES
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiaaM
-
Insert Size (bp)1674
-
Entrez GeneiaaM (a.k.a. PSA3335_RS05390, PSA3335_04970)
- Promoter pEF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTACGACCATTTTAATAGCCCAAGC
- 3′ sequencing primer ttaGTATCGATAACTAGCGTTAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vYM140_PB-pEFa1-iaaM(P.s)-Hygro was a gift from Michael Elowitz (Addgene plasmid # 160043 ; http://n2t.net/addgene:160043 ; RRID:Addgene_160043) -
For your References section:
Synthetic mammalian signaling circuits for robust cell population control. Ma Y, Budde MW, Mayalu MN, Zhu J, Lu AC, Murray RM, Elowitz MB. Cell. 2022 Mar 17;185(6):967-979.e12. doi: 10.1016/j.cell.2022.01.026. Epub 2022 Mar 1. 10.1016/j.cell.2022.01.026 PubMed 35235768