pI2-MTU-DO-HIS
(Plasmid
#160016)
-
Purpose(Empty Backbone) Integrative vector for K. marxianus, targeting integration site I2 described in (Rajkumar et al.,2019). Histidine selection.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneConstructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125031 and 125064)
-
Backbone manufacturerPartially Addgene
- Backbone size (bp) 5146
-
Vector typeYeast Expression ; Kluyveromyces marxianus
- Promoter n/a
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer tttgctggccttttgctc
- 3′ sequencing primer gtatgcagcagctttaaataat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pI2-MTU-DO-HIS was a gift from John Morrissey (Addgene plasmid # 160016 ; http://n2t.net/addgene:160016 ; RRID:Addgene_160016) -
For your References section:
Rational engineering of Kluyveromyces marxianus to create a chassis for the production of aromatic products. Rajkumar AS, Morrissey JP. Microb Cell Fact. 2020 Nov 11;19(1):207. doi: 10.1186/s12934-020-01461-7. 10.1186/s12934-020-01461-7 PubMed 33176787
