K20‐scFv‐pSMBP2
(Plasmid #159940)

• Purpose: To generate baculovirus for insect cell expression of anti beta-1 integrin scFv K20
• Depositing Lab: Sandra Schmid
• Publication: Lakoduk et al Traffic. 2020 Sep;21(9):590-602. doi: 10.1111/tra.12754. Epub 2020 Jul 21.

Backbone

• Vector backbone: pSMBP2
• Backbone size w/o insert (bp): 4800
• Total vector size (bp): 6754
• Modifications to backbone: Inserted two Sbf restriction sites flanking the MBP sequence for genetic removal of MBP.
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: anti beta-1 integrin scFv
• Alt name: single chain variable fragment
• Species: D. melanogaster (fly)
• Insert Size (bp): 1956
• Promoter: Polyhedrin
• Tags / Fusion Proteins:
  • 6xHis tag (N terminal on insert)
  • MBP fusion (N terminal on insert)
  • TEV site (N terminal on insert)
  • FLAG tag (C terminal on insert)
  • Sortase A recognition site (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: pFASTBAC For (GGATTATTCATACCGTCCCA)
• 3′ sequencing primer: pFASTBAC Rev (CAAATGTGGTATGGCTGATT)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry