pX330_gRNA_H19-DMR-1
(Plasmid
#159929)
-
PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerAddgene 42230
- Backbone size w/o insert (bp) 8506
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA mouse H19-DMR
-
Alt nameH19 differentially methylated region
-
gRNA/shRNA sequenceCATGAACTCAGAAGAGACTG
-
SpeciesM. musculus (mouse)
-
GenBank IDNG_042043
-
Entrez GeneH19-icr (a.k.a. H19-DMD, H19-DMR, Ic1, Icr1)
- Promoter U6, CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
- 3′ sequencing primer AAAAAAGCACCGACTCGGTGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330_gRNA_H19-DMR-1 was a gift from Anton Wutz (Addgene plasmid # 159929 ; http://n2t.net/addgene:159929 ; RRID:Addgene_159929) -
For your References section:
Polyploidy of semi-cloned embryos generated from parthenogenetic haploid embryonic stem cells. Aizawa E, Dumeau CE, Freimann R, Di Minin G, Wutz A. PLoS One. 2020 Sep 10;15(9):e0233072. doi: 10.1371/journal.pone.0233072. eCollection 2020. 10.1371/journal.pone.0233072 PubMed 32911495