pAAV-EF1a-NES-tdTomato-LINuS-WPRE
(Plasmid #159894)

• Purpose: AAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signal
• Depositing Lab: Tatsushi Onaka
• Publication: Inutsuka et al Biochem Biophys Res Commun. 2020 Jan 29;522(1):138-143. doi: 10.1016/j.bbrc.2019.11.023. Epub 2019 Nov 19.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Agilent
• Backbone size w/o insert (bp): 5335
• Total vector size (bp): 7318
• Modifications to backbone: CMV promoter→EF1α promoter beta-globin intron→WPRE
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NES-tdTomato-LINuS
• Species: Synthetic
• Insert Size (bp): 1983
• Promoter: EF1α promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: GCGTAAAAGGAGCAACATAG

Resource Information

• Supplemental Documents:
  • p131_pAAV-EF1a-NES(PKIt)-tdTomato-biLINuS10-WPRE..gb
• A portion of this plasmid was derived from a plasmid made by: LINuS is originally developed by Niopek et al. We synthesized the biLINuS10 sequence based on the paper (Niopek, 2014).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Niopek et al Nat Commun. 2014 Jul 14;5:4404. doi: 10.1038/ncomms5404.