Skip to main content
Addgene

pEGFP-CHAMP1
(Plasmid #159892)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159892 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech (TaKaRa)
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 7164
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHAMP1
  • Alt name
    CAMP (chromosome alignment-maintaining phosphoprotein), C13orf8, ZNF828
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2436
  • GenBank ID
    NM_032436 NM_001164144
  • Entrez Gene
    CHAMP1 (a.k.a. C13orf8, CAMP, CHAMP, MRD40, ZNF828)
  • Promoter CMV
  • Tag / Fusion Protein
    • pEGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified a partial deletion of the SV40 promoter compared to the hypothetical plasmid sequence. The depositing lab does not consider this to be of concern in regard to the function of this plasmid

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-CHAMP1 was a gift from Kozo Tanaka (Addgene plasmid # 159892 ; http://n2t.net/addgene:159892 ; RRID:Addgene_159892)

  • For your References section:

    CAMP (C13orf8, ZNF828) is a novel regulator of kinetochore-microtubule attachment. Itoh G, Kanno S, Uchida KS, Chiba S, Sugino S, Watanabe K, Mizuno K, Yasui A, Hirota T, Tanaka K. EMBO J. 2011 Jan 5;30(1):130-44. doi: 10.1038/emboj.2010.276. Epub 2010 Nov 9. 10.1038/emboj.2010.276 PubMed 21063390
Related items:
Commonly requested with: