AAVS1-Blasticidin XLone-eGFP
(Plasmid #159754)

• Purpose: AAVS1 donor plasmid for targeted inducible eGFP expression in human cells
• Depositing Lab: Xiaoping Bao
• Publication: Chang et al Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569.

Backbone

• Vector backbone: AAVS1-Blasticidin-CAG-Flpe-ERT2
• Backbone manufacturer: Addgene #68461
• Backbone size w/o insert (bp): 8381
• Total vector size (bp): 10858
• Vector type: Mammalian Expression, CRISPR, TALEN ; Donor plasmid for targeted knockin at the S1 safe harbor locus
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: all-in-one tet-on system
• Alt name: Xlone
• Species: Synthetic
• Insert Size (bp): 2474
• Promoter: TRE3GS inducible promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: gcgcctataaaagagtgctga
• 3′ sequencing primer: cgcctgtcttaggttggagt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC identified a discrepancy in the TetO array of the promoter compared the expected reference sequence. The construct is verified by the depositing lab as functional for inducible expression of eGFP in 293T cells.