Skip to main content
Addgene

lenti-25xUPRE-minP-EGFP
(Plasmid #159668)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCas9-Blast
  • Backbone manufacturer
    Feng Zhang
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    25xUPRE-minP-EGFP
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer AATTCTGCAGACAAATGGCAGTA
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-25xUPRE-minP-EGFP was a gift from Seiichi Oyadomari (Addgene plasmid # 159668 ; http://n2t.net/addgene:159668 ; RRID:Addgene_159668)
  • For your References section:

    Cell-based HTS identifies a chemical chaperone for preventing ER protein aggregation and proteotoxicity. Kitakaze K, Taniuchi S, Kawano E, Hamada Y, Miyake M, Oyadomari M, Kojima H, Kosako H, Kuribara T, Yoshida S, Hosoya T, Oyadomari S. Elife. 2019 Dec 17;8. pii: 43302. doi: 10.7554/eLife.43302. 10.7554/eLife.43302 PubMed 31843052