Integrin-β6 I domain I270C
(Plasmid
#159639)
-
PurposeContains integrin beta 6 residues 108–352 with I270C mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneET8
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIntegrin beta 6 I domain I270C
-
Alt nameb6 I domain
-
MutationI270C
-
Tag
/ Fusion Protein
- 6x His (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGTGGGGTGTTGGGG
- 3′ sequencing primer GGCTACGGCCTCCAAACCCTCTTCCAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Integrin-β6 I domain I270C was a gift from Timothy Springer (Addgene plasmid # 159639 ; http://n2t.net/addgene:159639 ; RRID:Addgene_159639) -
For your References section:
Force interacts with macromolecular structure in activation of TGF-beta. Dong X, Zhao B, Iacob RE, Zhu J, Koksal AC, Lu C, Engen JR, Springer TA. Nature. 2017 Feb 2;542(7639):55-59. doi: 10.1038/nature21035. Epub 2017 Jan 25. 10.1038/nature21035 PubMed 28117447