Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Integrin-β6 I domain I270C
(Plasmid #159639)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159639 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    ET8
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Integrin beta 6 I domain I270C
  • Alt name
    b6 I domain
  • Mutation
    I270C
  • Tag / Fusion Protein
    • 6x His (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGTGGGGTGTTGGGG
  • 3′ sequencing primer GGCTACGGCCTCCAAACCCTCTTCCAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Integrin-β6 I domain I270C was a gift from Timothy Springer (Addgene plasmid # 159639 ; http://n2t.net/addgene:159639 ; RRID:Addgene_159639)
  • For your References section:

    Force interacts with macromolecular structure in activation of TGF-beta. Dong X, Zhao B, Iacob RE, Zhu J, Koksal AC, Lu C, Engen JR, Springer TA. Nature. 2017 Feb 2;542(7639):55-59. doi: 10.1038/nature21035. Epub 2017 Jan 25. 10.1038/nature21035 PubMed 28117447