Integrin-β6 Headpiece I270C
(Plasmid
#159638)
-
PurposeContains integrin beta 6 residues 1–474 with I270C mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneET10
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIntegrin beta 6 headpiece I270C
-
Alt nameb6 headpiece I270C
-
Insert Size (bp)1300
-
MutationI270C
-
Tag
/ Fusion Protein
- 6x His (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGTGGGGTGTTGGGG
- 3′ sequencing primer GGCTACGGCCTCCAAACCCTCTTCCAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Integrin-β6 Headpiece I270C was a gift from Timothy Springer (Addgene plasmid # 159638 ; http://n2t.net/addgene:159638 ; RRID:Addgene_159638) -
For your References section:
Structural determinants of integrin beta-subunit specificity for latent TGF-beta. Dong X, Hudson NE, Lu C, Springer TA. Nat Struct Mol Biol. 2014 Dec;21(12):1091-6. doi: 10.1038/nsmb.2905. Epub 2014 Nov 10. 10.1038/nsmb.2905 PubMed 25383667