pJo55-CA1
(Plasmid
#159624)
-
PurposePlasmid pJo55, which contains positive control (C. annuum eIF4E-1) for complementation test in Jo55 yeasts.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJo55
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC. annuum eIF4E-1
-
Alt namepvr1
-
SpeciesC. annuum
-
Insert Size (bp)687
-
GenBank IDNM_001324970
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gacggtaggtattgattgta
- 3′ sequencing primer CCTAGACTTCAGGTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJo55-CA1 was a gift from Vasiliy Taranov (Addgene plasmid # 159624 ; http://n2t.net/addgene:159624 ; RRID:Addgene_159624) -
For your References section:
VPg of Potato Virus Y and Potato Cap-Binding eIF4E Factors: Selective Interaction and Its Supposed Mechanism. Lebedeva MV, Nikonova EY, Terentiev AA, Taranov VV, Babakov AV, Nikonov OS. Biochemistry (Mosc). 2021 Sep;86(9):1128-1138. doi: 10.1134/S000629792109008X. 10.1134/S000629792109008X PubMed 34565316