m6A-Tracer-NES
(Plasmid #159607)

• Purpose: Constitutive transient mammalian expression of m6A-Tracer protein (Kind et al. 2013) with a C-terminal HIV-1 Rev Nuclear Export Signal to reduce background due to nonspecific DNA interactions.
• Depositing Lab: Aaron Streets
• Publication: Altemose et al Cell Syst. 2020 Oct 21;11(4):354-366.e9. doi: 10.1016/j.cels.2020.08.015. Epub 2020 Sep 23.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 1100
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: m6A-Tracer-NES
• Alt name: eGFP-DpnI_d7-NES
• Species: Synthetic
• Insert Size (bp): 1100
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-F (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: SV40pA-R (GAAATTTGTGATGCTATTGC)

Resource Information

• Supplemental Documents:
  • m6a-tracer-nes.gb
• A portion of this plasmid was derived from a plasmid made by: modified from a gift from Bas van Steensel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

dam-/dcm- strain should be used for downstream applications