DD-DamWT-IRES2-mCherry
(Plasmid #159602)

• Purpose: Shield-1 inducible transient mammalian expression of Dam alone for DamID controls, containing the wild-type allele of Dam.
• Depositing Lab: Aaron Streets
• Publication: Altemose et al Cell Syst. 2020 Oct 21;11(4):354-366.e9. doi: 10.1016/j.cels.2020.08.015. Epub 2020 Sep 23.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 6415
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DD-DamWT-IRES2-mCherry
• Species: Synthetic
• Insert Size (bp): 2600
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-F (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: IRES-R (CCTCACATTGCCAAAAGACG)

Resource Information

• Supplemental Documents:
  • dd-damwt-ires2-mcherry.gb
• A portion of this plasmid was derived from a plasmid made by: modified from a gift from Bas van Steensel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

dam-/dcm- strain should be used for downstream applications
Addgene QC identified a partial deletion of the SV40 promoter compared to the hypothetical plasmid sequence. The depositing lab does not consider this to be of concern in regard to the function of this plasmid