pEJS1099: Dual-sgRNA.Design 4
(Plasmid #159537)

• Purpose: Delivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vector
• Depositing Lab: Erik Sontheimer
• Publication: Ibraheim et al Nat Commun. 2021 Nov 1;12(1):6267. doi: 10.1038/s41467-021-26518-y.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: p1089: minimized AAV.sgRNA.Nme2Cas9
• Vector type: Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nme2Cas9 with two guide RNA cassettes
• Alt name: Neisseria meningitidis Cas9 nuclease
• Alt name: Nme2Cas9c
• Insert Size (bp): 4523
• Promoter: U1a
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EagI (unknown if destroyed)
• 3′ cloning site: None (unknown if destroyed)
• 5′ sequencing primer: gatctccaccatagcccatc
• 3′ sequencing primer: tgcacaagtatgacctgatcg

Resource Information

• Supplemental Documents:
  • pEJS1099 Dual-sgRNA.Design 4.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.10.09.333997v1 for BioRxiv preprint