Skip to main content
Addgene

pEJS1099: Dual-sgRNA.Design 4
(Plasmid #159537)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159537 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    p1089: minimized AAV.sgRNA.Nme2Cas9
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nme2Cas9 with two guide RNA cassettes
  • Alt name
    Neisseria meningitidis Cas9 nuclease
  • Alt name
    Nme2Cas9c
  • Insert Size (bp)
    4523
  • Promoter U1a
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EagI (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer gatctccaccatagcccatc
  • 3′ sequencing primer tgcacaagtatgacctgatcg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS1099: Dual-sgRNA.Design 4 was a gift from Erik Sontheimer (Addgene plasmid # 159537 ; http://n2t.net/addgene:159537 ; RRID:Addgene_159537)

  • For your References section:

    Self-inactivating, all-in-one AAV vectors for precision Cas9 genome editing via homology-directed repair in vivo. Ibraheim R, Tai PWL, Mir A, Javeed N, Wang J, Rodriguez TC, Namkung S, Nelson S, Khokhar ES, Mintzer E, Maitland S, Chen Z, Cao Y, Tsagkaraki E, Wolfe SA, Wang D, Pai AA, Xue W, Gao G, Sontheimer EJ. Nat Commun. 2021 Nov 1;12(1):6267. doi: 10.1038/s41467-021-26518-y. 10.1038/s41467-021-26518-y PubMed 34725353
Related items:
Commonly requested with: