Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pQdCas9-sgempty
(Plasmid #159523)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159523 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBBRMCS2
  • Vector type
    CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    the plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    quorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dcas9 and sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    6000
  • Promoter quorum sensing promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGGATCTCGTCGTGACCCATG
  • 3′ sequencing primer AAACGGAGGAATGGGAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQdCas9-sgempty was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 159523 ; http://n2t.net/addgene:159523 ; RRID:Addgene_159523)
  • For your References section:

    Dynamic Cell Programming with Quorum Sensing-Controlled CRISPRi Circuit. Liu Y, Chen J, Crisante D, Jaramillo Lopez JM, Mahadevan R. ACS Synth Biol. 2020 Jun 5. doi: 10.1021/acssynbio.0c00148. 10.1021/acssynbio.0c00148 PubMed 32485106