pAV-U6+27-Linear-1_PolyU(2)
(Plasmid
#159480)
-
PurposeTests for the impact of 2 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTermination Module:Linear-1_PolyU(2)
-
SpeciesSynthetic
- Promoter U6-27
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer F_U6. MV.o87:GAAAGTAATAATTTCTTGGGTAGTTTG
- 3′ sequencing primer MV.O12:gcaataaacaagttactagtcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAV-U6+27-Linear-1_PolyU(2) was a gift from Julius Lucks (Addgene plasmid # 159480 ; http://n2t.net/addgene:159480 ; RRID:Addgene_159480) -
For your References section:
RNA Sequence and Structure Determinants of Pol III Transcriptional Termination in Human Cells. Verosloff MS, Corcoran WK, Dolberg TB, Bushhouse DZ, Leonard JN, Lucks JB. J Mol Biol. 2021 Jun 25;433(13):166978. doi: 10.1016/j.jmb.2021.166978. Epub 2021 Apr 1. 10.1016/j.jmb.2021.166978 PubMed 33811918