Th-tdTomato
(Plasmid #159460)

• Purpose: Targeting vector to TH gene locus for induction of P2A-fused tdTomato, with floxed PGK-puroR drug resistant cassette
• Depositing Lab: Yuejun Chen
• Publication: Xiong et al Cell Stem Cell. 2020 Sep 16. pii: S1934-5909(20)30410-0. doi: 10.1016/j.stem.2020.08.014.

Backbone

• Vector backbone: PL552
• Backbone manufacturer: Su-Chun Zhang Lab
• Backbone size w/o insert (bp): 5293
• Vector type: Mammalian Expression, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: P2A-tdTomato
• Species: Synthetic
• Insert Size (bp): 1500
• Promoter: Endogenous TH
• Tag / Fusion Protein:
  • P2A (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctctcctccccaggagctat
• 3′ sequencing primer: ctggggaggggtcacaggg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry