AAVS1-pur-CAG-Bi-DREADD
(Plasmid #159457)

• Purpose: AAVS1 targeting donor plasmid with Bi-DREADD expression cassette and puromycin selection gene
• Depositing Lab: Yuejun Chen
• Publication: Xiong et al Cell Stem Cell. 2020 Sep 16. pii: S1934-5909(20)30410-0. doi: 10.1016/j.stem.2020.08.014.

Backbone

• Vector backbone: AAVS1-CAG
• Backbone size w/o insert (bp): 10200
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bi-DREADD
• Alt name: hM3Dq-mCherry-P2A-HA-KORD
• Species: Synthetic
• Insert Size (bp): 3741
• Mutation: fusion protein of hM3Dq-mCherry and HA-KORD seperated by P2A sequence
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ggcttctggcgtgtgaccggc
• 3′ sequencing primer: catagcgtaaaaggagcaaca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry