mCRISPRed pRSETB
(Plasmid
#159454)
-
PurposeExpresses the pH-resistant long Stokes shift red fluorescent protein mCRISPRed
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRSETB
-
Backbone manufacturerInvitrogen/Thermofisher Scientific
- Backbone size w/o insert (bp) 2901
- Total vector size (bp) 3609
-
Modifications to backboneIncreased His-Tag length to 10 x from the original 6 x
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCRISPRed
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)708
-
GenBank IDMN844880.1 MN844880.1
- Promoter T7
-
Tag
/ Fusion Protein
- 10 x His-Tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer GCTTCCTTTCGGGCTTTGTTAGCAGCCGGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCRISPRed pRSETB was a gift from Oliver Griesbeck (Addgene plasmid # 159454 ; http://n2t.net/addgene:159454 ; RRID:Addgene_159454) -
For your References section:
Targeted In Situ Protein Diversification and Intra-organelle Validation in Mammalian Cells. Erdogan M, Fabritius A, Basquin J, Griesbeck O. Cell Chem Biol. 2020 May 21;27(5):610-621.e5. doi: 10.1016/j.chembiol.2020.02.004. Epub 2020 Mar 5. 10.1016/j.chembiol.2020.02.004 PubMed 32142629