pCL28-decoder
(Plasmid #159450)

• Purpose: Insert: PlexAtet-lexA-ER-B112-tCyc1. The transcription factor LexA-ER-B112 (see addgene FRP880) is self-inducible upon addition of estradiol, and repressible by TetR. Backbone: pRG206MX. Marker: Ura3.
• Depositing Lab: Joerg Stelling
• Publication: Lormeau et al Nat Commun. 2021 Mar 25;12(1):1886. doi: 10.1038/s41467-021-22190-4.

Backbone

• Vector backbone: pRG206MX
• Backbone manufacturer: addgene
• Backbone size w/o insert (bp): 4302
• Total vector size (bp): 7109
• Vector type: Yeast Expression, Synthetic Biology
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PlexAtet-LexA-ER-B112-tCyc1
• Species: Synthetic
• Insert Size (bp): 2807
• Promoter: PlexAtet

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: AATTAACCCTCACTAAAGGG

Resource Information

• Supplemental Documents:
  • pcl28-decoder.gb
• A portion of this plasmid was derived from a plasmid made by: part of the insert from addGene FRP880_PACT1(-1-520)-LexA-ER-haB112-TCYC1. part of the promoter from addGene FRP793_insul-(lexA-box)4-PminCYC1-Citrine-TCYC1.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry