Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCL21-decoder
(Plasmid #159448)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159448 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRG201
  • Backbone manufacturer
    addgene
  • Backbone size w/o insert (bp) 5292
  • Total vector size (bp) 8374
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    Met15

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pact1-lexA-ER-B112-phosphodegron-tCyc1
  • Insert Size (bp)
    3082
  • Promoter act1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AATTAACCCTCACTAAAGGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    part of the insert from addGene FRP880_PACT1(-1-520)-LexA-ER-haB112-TCYC1. phosphodegron tag inserted before stop codon, sequence from Gordley, R. M. et al. Engineering dynamical control of cell fate switching using synthetic phospho-regulons. Proc Natl Acad Sci U S A 113, 13528-13533, doi:10.1073/pnas.1610973113 (2016).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCL21-decoder was a gift from Joerg Stelling (Addgene plasmid # 159448 ; http://n2t.net/addgene:159448 ; RRID:Addgene_159448)
  • For your References section:

    A rationally engineered decoder of transient intracellular signals. Lormeau C, Rudolf F, Stelling J. Nat Commun. 2021 Mar 25;12(1):1886. doi: 10.1038/s41467-021-22190-4. 10.1038/s41467-021-22190-4 PubMed 33767179