Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3-P1-N-miRFP670-C
(Plasmid #159438)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159438 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Total vector size (bp) 6432
  • Vector type
    CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miRFP670
  • Insert Size (bp)
    945
  • Promoter CMV
  • Tags / Fusion Proteins
    • 5' linker pair 1 (N terminal on backbone)
    • N terminal peptide linker (N terminal on insert)
    • C terminal peptide linker (C terminal on insert)
    • 3' linker pair 1 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer GAAAGGACAGTGGGAGTGGCACCTTCCAGGGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-P1-N-miRFP670-C was a gift from Jianhua Xing (Addgene plasmid # 159438 ; http://n2t.net/addgene:159438 ; RRID:Addgene_159438)
  • For your References section:

    Rapid, modular, and cost-effective generation of donor DNA constructs for CRISPR-based gene knock-in. Chen YJ, Cheng YY, Wang W, Tian XJ, Lefever DE, Taft DA, Zhang J, Xing J. Biol Methods Protoc. 2020 Mar 20;5(1):bpaa006. doi: 10.1093/biomethods/bpaa006. eCollection 2020. 10.1093/biomethods/bpaa006 PubMed 32411820