PX458-Lck
(Plasmid
#159430)
-
PurposeCRISPR knockout of Lck
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 159430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 9271
- Total vector size (bp) 9291
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting Lck exon 2
-
gRNA/shRNA sequenceGACCCACTGGTTACCTACGA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001042771.2
-
Entrez GeneLCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPX458 backbone vector from Addgene #48138 (Feng Zhang Lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-Lck was a gift from Arthur Salomon (Addgene plasmid # 159430 ; http://n2t.net/addgene:159430 ; RRID:Addgene_159430) -
For your References section:
Quantitative Interactomics of Lck-TurboID in Living Human T Cells Unveils T Cell Receptor Stimulation-Induced Proximal Lck Interactors. Chua XY, Aballo T, Elnemer W, Tran M, Salomon A. J Proteome Res. 2020 Nov 13. doi: 10.1021/acs.jproteome.0c00616. 10.1021/acs.jproteome.0c00616 PubMed 33185455