Skip to main content
Addgene

pL0-NbPT5bPro
(Plasmid #159416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159416 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pICH41295
  • Backbone manufacturer
    47997 (Sylvestre Marillonnet)
  • Backbone size w/o insert (bp) 2251
  • Total vector size (bp) 3319
  • Vector type
    Bacterial Expression ; pUC19-derived

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NbPT5b Promoter
  • Alt name
    Phosphate Transporter 5b Promoter
  • Species
    Nicotiana benthamiana
  • Insert Size (bp)
    1068

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer MoClo_lv0_F0015: CGTTATCCCCTGATTCTGTGGATAAC
  • 3′ sequencing primer MoClo_lv0_R0016: GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL0-NbPT5bPro was a gift from Sam Brockington (Addgene plasmid # 159416 ; http://n2t.net/addgene:159416 ; RRID:Addgene_159416)
  • For your References section:

    MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583