Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL0-MtBCP1Pro
(Plasmid #159415)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159415 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pICH41295
  • Backbone manufacturer
    47997 (Sylvestre Marillonnet)
  • Backbone size w/o insert (bp) 2251
  • Total vector size (bp) 3359
  • Vector type
    Bacterial Expression ; pUC19-derived

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MtBCP1 Promoter
  • Species
    Medicago truncatula
  • Insert Size (bp)
    1108

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer MoClo_lv0_F0015: CGTTATCCCCTGATTCTGTGGATAAC
  • 3′ sequencing primer MoClo_lv0_R0016: GTCTCATGAGCGGATACATATTTGAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL0-MtBCP1Pro was a gift from Sam Brockington (Addgene plasmid # 159415 ; http://n2t.net/addgene:159415 ; RRID:Addgene_159415)
  • For your References section:

    MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583
Commonly requested with: