Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a 6xHis PreScission SARS-CoV-2 nsp13
(Plasmid #159390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159390 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5297
  • Total vector size (bp) 7108
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    N-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    1812
  • GenBank ID
    MT121215.1
  • Promoter T7
  • Tag / Fusion Protein
    • His6 tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence was optimized by GenScript for insect cell expression using the OptimumGene Codon Optimization Analysis.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a 6xHis PreScission SARS-CoV-2 nsp13 was a gift from Tarun Kapoor (Addgene plasmid # 159390 ; http://n2t.net/addgene:159390 ; RRID:Addgene_159390)
  • For your References section:

    Structural basis for helicase-polymerase coupling in the SARS-CoV-2 replication-transcription complex. Chen J, Malone B, Llewellyn E, Grasso M, Shelton PMM, Olinares PDB, Maruthi K, Eng ET, Vatandaslar H, Chait B, Kapoor T, Darst SA, Campbell EA. bioRxiv. 2020 Jul 13. doi: 10.1101/2020.07.08.194084. 10.1101/2020.07.08.194084 PubMed 32676607