Skip to main content
Addgene

human TLNRD1-F250D pET151
(Plasmid #159385)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159385 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 1086
  • Total vector size (bp) 6846
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Talin Rod Domain Containing Protein 1 F250D mutant
  • Alt name
    TLNRD1-F250D
  • Species
    H. sapiens (human)
  • Mutation
    Changed Phenylalanine 250 to Aspartic Acid (F250D)
  • Entrez Gene
    TLNRD1 (a.k.a. MESDC1)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human TLNRD1-F250D pET151 was a gift from Ben Goult (Addgene plasmid # 159385 ; http://n2t.net/addgene:159385 ; RRID:Addgene_159385)

  • For your References section:

    Talin rod domain-containing protein 1 (TLNRD1) is a novel actin-bundling protein which promotes filopodia formation. Cowell AR, Jacquemet G, Singh AK, Varela L, Nylund AS, Ammon YC, Brown DG, Akhmanova A, Ivaska J, Goult BT. J Cell Biol. 2021 Sep 6;220(9). pii: 212472. doi: 10.1083/jcb.202005214. Epub 2021 Jul 15. 10.1083/jcb.202005214 PubMed 34264272
Related items:
Commonly requested with: