pET11a-TAX-L10-STEPtag
(Plasmid #159375)

• Purpose: Expresses STEPtag fused to the C-terminus of inactive T. aurantiacus xylanase 10A, as a mock protein of interest.
• Depositing Lab: Roberto Chica
• Publication: Eason et al ACS Synth Biol. 2020 Nov 20;9(11):2955-2963. doi: 10.1021/acssynbio.0c00407. Epub 2020 Oct 12.

Backbone

• Vector backbone: pET-11a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5677
• Total vector size (bp): 7015
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TAX-L10-STEPtag
• Species: Synthetic
• Insert Size (bp): 1374
• Promoter: T7
• Tag / Fusion Protein:
  • 6x His tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: T7 TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7 Terminal GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET11a TAX-L10-STEPtag.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

TAX can be replaced with a protein of interest using the NdeI and XhoI sites. Ensure that the flexible ten amino acid linker between STEPtag and the protein of interest is present in the new fusion.